P5E-Fse-Asc
From Tol2Kit
[edit] Construction details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
[edit] Sequence
Annotated sequence, Genbank format:
p5E-Fse-Asc Genbank
FASTA file with the full-length sequence as well as sequences of individual components:
p5E-Fse-Asc sequence


